ggaB [2018-11-19 19:10:40]

galactosamine-containing minor teichoic acid biosynthesis, membrane protein

Locus: BSU35680

Isoelectric point: 9.48

Molecular weight: 106.96 kDa

Protein length: 900 aa

Gene length: 2700 bp

Function: biosynthesis of teichoic acid

Product: unknown

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of teichoic acid
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of teichoic acid
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,667,209 → 3,669,911

The protein

Protein family

• glycosyltransferase 2 family (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: ggaA-ggaB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Additional information

  • an antisense RNA is predicted for ggaA PubMed
  • PhoP∼P binds to the promoter region, but regulation has not been explored PubMed

Biological materials

Mutant

• BKE35680 (ΔggaB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAAAGATTACTCCTAAC, downstream forward: _UP4_TGAGGTTGGTTTGTTTTATA
• BKK35680 (ΔggaB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAAAGATTACTCCTAAC, downstream forward: _UP4_TGAGGTTGGTTTGTTTTATA

References

Loading